rs79577862 chr4:77095541 G>T
- Sequence
gctgaccttggcatgccactaggg[G/T]gccgctgcctcatagtatatactt
- ASB in cell types
- Raji (Burkitt lymphoma)
- ASB for transcription factors
- ZN768_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN768_HUMAN | 2.74 | -2.62 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1