rs796825 chr3:120298633 G>A
- Sequence
ctgcaggaattttttgcatattat[G/A]gatagtaactctttaatatgttgt
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | n/a | 2.94 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
PheWAS abnormal glucose, abnormal kidney function, abnormal thyroid function, abnormality of gait, acquired spondylolisthesis, acute, but ill-defined cerebrovascular disease, allergic reaction to food, arthropathy nos involving multiple sites, bacterial enteritis, benign neoplasm of brain and other parts of nervous system, calcaneal spur, exostosis nos, cancer of larynx, cancer, suspected or other, cardiac arrest & ventricular fibrillation, cardiac arrhythmia nos, celiac disease, celiac or tropical sprue, cervicocranial/cervicobrachial syndrome, chronic bronchitis, coma, stupor, and brain damage, congenital anomalies of urinary system, corneal degenerations, cystic kidney disease, degenerative disease of the spinal cord, dermatophytosis, dermatophytosis / dermatomycosis, dermatophytosis of the body, diabetic retinopathy, disorders of other cranial nerves, diverticulum of esophagus, acquired, duodenal ulcer, dyschromia and vitiligo, fuchs dystrophy, gastrointestinal malfunction arising from mental factors, gastroparesis, gout, gout and other crystal arthropathies, hallux rigidus, infertility, male, intestinal infection due to c. difficile, irregular menstrual bleeding, keratitis, localized adiposity, lump or mass in breast, male infertility and abnormal spermatozoa, malignant neoplasm, other, miscarriage, stillbirth, mucous polyp of cervix, nerve plexus lesions, nerve root and plexus disorders, nonallopathic lesions nec, obstructive chronic bronchitis, osteoarthrosis, localized, primary, other abnormal glucose, other cerebral degenerations, other conditions of brain, nos, other congenital anomalies of skin, other dyschromia, polycystic ovaries, polyp of corpus uteri, polyp of female genital organs, primary thrombocytopenia, random mental disorder. ignored for now, reflux esophagitis, renal osteodystrophy, stricture of artery, thyrotoxicosis, torticollis, type 1 diabetic neuropathy, type 2 diabetic retinopathy, ulceration of intestine, unstable angina (intermediate coronary syndrome), urinary calculus, varicose veins of lower extremity, symptomtic