rs797775 chr12:6201994 C>T
- Sequence
caaggctgcggtgagtcatgattg[C/T]accactgcacttagcctgggtgac
- ASB in cell types
- HepG2 (hepatoblastoma) breast tumor tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.42 | -0.37 | 1.20 | |||
| breast tumor | 2.10 | -1.05 | 2.00 | |||
| tibial nerve | 2.17 | -1.95 | 1.33 |
Items per page:
1 – 3 of 3