rs797963 chr17:29283579 G>A
- Sequence
ttacagtcatgacccaccacactg[G/A]gcctcccagaatattttggaggtg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 1.85 | -1.51 | 1.00 |
Items per page:
1 – 1 of 1