rs799487 chr14:34981225 A>T
- Sequence
acacacacacacacacacacacac[A/T]ctctcgcatacaggcataggatag
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.39 | 0.19 | 1.88 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.31 | 1.20 | 1.21 | |||
| K562 (myelogenous leukemia) | 0.26 | 2.15 | 2.67 |
Items per page:
1 – 3 of 3