rs799570 chr3:111967891 G>A
- Sequence
ggtggcagttcctagaagacagct[G/A]ttctgtgtctgaggatgctttcct
- ASB in cell types
- HCT-116 (colon carcinoma) HCT-116-RAD21-mAC keratinocytes WA09 (embryonic stem cells)
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | 2.42 | -3.91 | 1.50 | -3.35 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), fasting insulin, homa-ir, ldl cholesterol change with statins, total cholesterol, type 1 diabetes, rheumatoid arthritis, crohns disease, combined case analysis, gender differentiated