rs799976 chr7:80453775 T>G
- Sequence
ttataatatactactgagttaaag[T/G]caaaaaatatactatgattcttaa
- ASB in cell types
- PC9 (lung adenocarcinoma) IPSC-derived bipolar neuron bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | 3.23 | n/a | 2.00 | |||
| IPSC-derived bipolar neuron | -0.55 | 2.40 | 1.00 | |||
| bipolar neuron | -1.16 | 1.16 | 1.00 |
Items per page:
1 – 3 of 3