rs806528 chr19:1490421 A>C
- Sequence
ccgccgagtgggcccaggcgtccg[A/C]cccgcccccggcgccatagcaacg
- ASB in cell types
- K562 (myelogenous leukemia) hTERT-HME1(Telomerase immortalized cell line) brain prefrontal cortex region tissues
- ASB for transcription factors
- NRF1_HUMAN VEZF1_HUMAN BRCA2_HUMAN RBM25_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 0.34 | 0.78 | 1.89 | n/a | No Hit | |||
| VEZF1_HUMAN | n/a | 2.24 | 2.00 | 5.69 | Concordant | |||
| BRCA2_HUMAN | -2.96 | 1.77 | 1.50 | n/a | n/a | |||
| RBM25_HUMAN | 1.14 | -0.43 | 4.00 | n/a | n/a | |||
| OLIG2_HUMAN | -0.52 | 1.83 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood