rs8070 chr3:112013761 G>A
- Sequence
gaactatgcaaagactccgcttcc[G/A]ttttcctgagctcctcgggcccca
- ASB in cell types
- RWPE1 (prostate epithelial cells) RWPE2 TTC-1240 (Rhabdoid tumor of the kidney) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE1 (prostate epithelial cells) | 3.87 | -4.01 | 1.00 | |||
| RWPE2 | 1.99 | -1.99 | 1.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | 3.14 | -3.48 | 1.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 1.28 | -1.28 | 1.00 | |||
| HCT-116 (colon carcinoma) | 0.63 | 1.40 | 1.21 |
Items per page:
1 – 5 of 6