rs807593 chr2:15655655 T>A
- Sequence
ctcaggcagtggaagccgcaaagt[T/A]gttttaagcatgaatgagacatgt
- ASB in cell types
- PC9 (lung adenocarcinoma)
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 1.78 | -0.66 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1