rs807787 chr4:40150036 A>G
- Sequence
ctagtgcatgctgccacctgtggt[A/G]gtctgtagttactgtcagtcacca
- ASB in cell types
- foreskin keratinocyte OCI-LY7 (diffuse large B-cell lymphoma) primary human epidermal keratinocytes
- ASB for transcription factors
- SMC1A_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC1A_HUMAN | 2.95 | n/a | 2.00 | n/a | n/a | |||
| STAG1_HUMAN | 0.77 | -0.07 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, fasting blood glucose, hip bone mineral density (bmd), homa-ir, maternal transmission distortion, microalbuminuria, paternal transmission distortion, spine bone mineral density (bmd), stabilized warfarin dose, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis