rs809123 chr5:132802472 T>C
- Sequence
aagcctggtgcagtgacacatgcc[T/C]gtagtgccacctagttgagaggct
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM18526 (B – cells Lymphoblastoid Cell Lines) SUM159PT (Triple negative breast cancer) GM02630 (Fanconi anemi)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.98 | -0.82 | 2.69 | -0.33 | Weak Concordant | |||
| STAG1_HUMAN | 1.23 | -5.26 | 4.90 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid