rs8098460 chr18:7272547 A>G
- Sequence
aggcccatataaaaatttatttat[A/G]tatttttttctctgccaagccaga
- ASB in cell types
- neural cell foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.17 | 0.94 | 1.00 | |||
| foreskin keratinocyte | 0.91 | n/a | 2.83 |
Items per page:
1 – 2 of 2