rs8099398 chr18:10518728 A>C
- Sequence
gaaggatgagggcagtcacatgtg[A/C]aacggctgcagtgttcatctgtga
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -0.44 | 1.71 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 1.38 | -0.68 | 1.00 |
Items per page:
1 – 2 of 2