rs8100159 chr19:1905726 G>C
- Sequence
ctgcgcgtgtgcgcccttatggtc[G/C]gtgcgggagaccccgtatcctcca
- ASB in cell types
- K562 (myelogenous leukemia) CD14+ monocytes HUVEC-C (HUVEC, umbilical vein endothelial cells) breast tumor
- ASB for transcription factors
- STAT1_HUMAN MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.48 | -1.65 | 2.00 | n/a | No Hit | |||
| MNT_HUMAN | -0.38 | 1.66 | 1.75 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach