rs8100561 chr19:799342 G>C
- Sequence
gggacctacgggctctcctggccc[G/C]gggacagctgggtgctcctgctgc
- ASB in cell types
- K562 (myelogenous leukemia) esophagus squamous epithelium
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.07 | 0.68 | 1.99 | |||
| esophagus squamous epithelium | 2.12 | -1.78 | 1.00 |
Items per page:
1 – 2 of 2