rs8100801 chr19:58380693 A>G
- Sequence
tggagcctcccctcgcgggcttca[A/G]tgacacccagcacggaaacgcggg
- ASB in cell types
- primary B-CLL cells HS-SY-2(Monophasic synovial sarcoma) EA.hy 926 (human umbilical vein endothelial cell line) GM18486 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- KDM2B_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM2B_HUMAN | -0.11 | 3.06 | 2.00 | n/a | n/a | |||
| STAT1_HUMAN | 2.40 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP normoxic and mild-hypoxic adaptation in populations residing at low and moderate altitudes, prop taste detection threshold, schizophrenia, serum creatinine, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellum, Brain_Hippocampus, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach