rs8101112 chr19:247111 T>C
- Sequence
cctgctggcagctggggacactgc[T/C]gggccctcttgcttgcagtgtagt
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) MCF7 (Invasive ductal breast carcinoma) epithelial cell of prostate OCI-LY1 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.11 | 0.09 | 2.19 | -0.16 | Weak Concordant | |||
| STAG1_HUMAN | 0.64 | n/a | 2.58 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
