rs8101443 chr19:17395025 G>C
- Sequence
tgggaggatactccactgacttac[G/C]gttggcagagtttaggctgccacg
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines) GM18951 (B-cells Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.12 | 2.48 | 1.51 | n/a | No Hit | |||
| STAG1_HUMAN | 0.06 | 2.03 | 1.48 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Mucosa, Nerve_Tibial