rs8103121 chr19:48654881 A>G
- Sequence
gtcccagatgtggatttcatgcct[A/G]ttcgtctcgggtgctgggaacaaa
- ASB in cell types
- RH4 (alveolar rhabdomyosarcoma) RPMI8226 (Plasma cell myeloma)
- ASB for transcription factors
- IKZF1_HUMAN HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 0.68 | 1.69 | 1.00 | n/a | n/a | |||
| HDAC1_HUMAN | 2.27 | -1.94 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cystatin c in serum, infant head circumference, urinary albumin-to-creatinine ratio
GTEx eQTL Brain_Hippocampus, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Minor_Salivary_Gland, Pancreas