rs8103870 chr19:2956764 T>C
- Sequence
gttgcccaggctggagtgcaatgg[T/C]gtgatcgatctgatctcggctcac
- ASB in cell types
- K562 (myelogenous leukemia) GM02610 (Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.21 | 0.85 | 2.08 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -0.61 | 2.35 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -0.49 | 0.90 | 1.00 |
Items per page:
1 – 3 of 3