rs8103872 chr19:50772742 C>G
- Sequence
tccggaatgcagatgtatcagtta[C/G]cttttgctgtgtaacaaaaacctt
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.02 | 0.79 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.44 | 0.47 | 1.00 |
Items per page:
1 – 2 of 2