rs8104483 chr19:44869097 T>G
- Sequence
gtaacacatgaaaccacagccgtt[T/G]tccataatacaaaggacagctctt
- ASB in cell types
- CD14+ monocytes HepG2 (hepatoblastoma) macrophages form periferal blood
- ASB for transcription factors
- STAT1_HUMAN SOX13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.34 | -4.07 | 2.00 | -3.53 | Concordant | |||
| SOX13_HUMAN | -0.72 | 1.22 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), alzheimers disease, aortic valve calcium, hdl cholesterol, late onset alzheimers disease, ldl cholesterol, maternal transmission distortion, total cholesterol, triglycerides
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Liver, Lung, Muscle_Skeletal, Pancreas, Pituitary, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood