rs8105636 chr19:42881478 A>C
- Sequence
gaacggcagcaattccaggccagg[A/C]tgcatgttttattccacgtggatc
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) primary human epidermal keratinocytes HCT-116 (colon carcinoma)
- ASB for transcription factors
- CTCF_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.03 | 0.07 | 2.21 | n/a | No Hit | |||
| BRD4_HUMAN | 2.22 | -1.39 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Amygdala, Brain_Hippocampus, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood