rs8106869 chr19:33184433 A>G
- Sequence
cagcagcgccatctatcggacgct[A/G]attcggagcttatgccgccttctg
- ASB in cell types
- THP-1 (acute monocytic leukemia) GM19193 (female B-cells Lymphoblastoid Cell Lines) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.46 | 1.49 | 1.17 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.54 | -1.38 | 1.00 | |||
| epidermal keratinocytes | -0.48 | 2.54 | 2.00 |
Items per page:
1 – 3 of 3