rs8108463 chr19:45568803 T>C
- Sequence
agagacggtgctgggatggggatg[T/C]gacgcagggtggaccactggattc
- ASB in cell types
- HEK293 (embryonic kidney) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.83 | 0.27 | 1.61 | |||
| A549 (lung carcinoma) | 1.03 | -0.01 | 1.20 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, infant head circumference, ldl cholesterol, parkinsons disease, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg