rs8108510 chr19:1773354 A>G
- Sequence
cacaggcatcacttgcatttaatc[A/G]taaaacctgaaaccgcagttagaa
- ASB in cell types
- MCF10A (breast epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10A (breast epithelial cells) | 1.44 | -0.54 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, obesity with early age of onset (age >2), paternal transmission distortion, refractive error, salmonella-induced pyroptosis, tardive dyskinesia, triglycerides