rs8109841 chr19:13731696 G>T
- Sequence
ggtcgccctgacaacagcgccggc[G/T]tctgggctgagcttcggactcgca
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ILF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ILF3_HUMAN | -1.34 | 2.27 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1