rs8110515 chr19:11137750 T>G
- Sequence
cctcagagcctcagtttccccacc[T/G]gacaatggagacaaagctaatctc
- ASB in cell types
- MS-1 (Small cell lung carcinoma) upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 1.01 | -0.62 | 1.00 | |||
| upper lobe of left lung | 2.14 | -1.81 | 1.00 |
Items per page:
1 – 2 of 2