rs8111890 chr19:247288 A>T
- Sequence
cgccacctcctggcagctaaggac[A/T]ctgcagggccctcttgctcacagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) Peyer's patch pancreas neural cell
- ASB for transcription factors
- CTCF_HUMAN TRI22_HUMAN STAG1_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.96 | 1.48 | 2.38 | n/a | No Hit | |||
| TRI22_HUMAN | 2.74 | -2.23 | 1.00 | n/a | n/a | |||
| STAG1_HUMAN | 1.68 | -3.76 | 3.00 | n/a | n/a | |||
| JUN_HUMAN | 2.28 | -1.25 | 1.00 | n/a | No Hit | |||
| ZN654_HUMAN | 2.09 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood