rs8112209 chr19:45570214 G>A
- Sequence
gaaaaagatccctgttcagaaatc[G/A]gccagaagatttagccatgagtac
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -1.42 | 1.48 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 1.55 | -1.29 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, infant head circumference, ldl cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg