rs8112213 chr19:46840786 C>T
- Sequence
ggctggagagcagtggctcgatct[C/T]ggctcactgcaatctctgcctctt
- ASB in cell types
- HCAEC (human coronary artery endothelial cells) T cells from peripheral blood HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCAEC (human coronary artery endothelial cells) | 1.98 | -1.05 | 1.00 | |||
| T cells from peripheral blood | 2.27 | -2.27 | 1.00 | |||
| HMEC (human mammary epithelial cells) | 2.12 | -1.78 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg