rs8112766 chr19:54875464 A>G
- Sequence
gcctgaagcaccattcttatttta[A/G]tccccattctagttgtttctgctg
- ASB in cell types
- MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.39 | -0.10 | 2.10 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Breast_Mammary_Tissue, Lung, Nerve_Tibial, Whole_Blood