rs8113423 chr19:2542675 A>G
- Sequence
aggcgtgttgctctaagccaccac[A/G]tatgcagtagtttcttatgcagtg
- ASB in cell types
- HKC8 (kidney proximal tubule cell line)
- ASB for transcription factors
- EPAS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EPAS1_HUMAN | -1.49 | 2.47 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, birth weight, hip bone mineral density (bmd), infant head circumference, longstanding arthritis, refractive error, rheumatoid arthritis, spine bone mineral density (bmd)