rs8115763 chr20:37179804 C>T
- Sequence
tcagtgaaaggggcaaagaaaacc[C/T]tcacttctctctgggagcctggag
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.06 | 0.88 | 1.99 | |||
| HEK293 (embryonic kidney) | -0.12 | 0.71 | 2.01 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.56 | 0.81 | 1.11 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, fasting blood glucose, height, rheumatoid arthritis, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid