rs8118690 chr20:44817346 G>T
- Sequence
aacgattattgtcacatcattgtg[G/T]tcactgtgattcagcaaattctca
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NFE2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFE2_HUMAN | 3.13 | n/a | 2.00 | -0.40 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, triglycerides change with statins, waist hip ratio
GTEx eQTL Adrenal_Gland, Artery_Aorta, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Thyroid