rs8119351 chr20:35166602 G>A
- Sequence
ctctctggagtaggaaacaccacc[G/A]cttgcttccttcatttccctttgc
- ASB in cell types
- EA.hy 926 (human umbilical vein endothelial cell line)
- ASB for transcription factors
- HIF1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HIF1A_HUMAN | n/a | 2.65 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cognitive response to topiramate treatment as measured by the controlled oral word association cognitive test, diastolic blood pressure (dbp), height, normalized agkistrodon contortrix venom ratio in venous thrombosis, plasma protein c levels, plasma protein c levels in venous thrombosis, plasma protein-c levels, prothrombin time by inr (international normalized ratio), refractive error, venous thrombosis
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood