rs8121302 chr20:17903397 T>C
- Sequence
actgagaagggatttatgcaagac[T/C]gggtgcaagagctgggcaagctga
- ASB in cell types
- germinal center B-cells
- ASB for transcription factors
- CBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CBP_HUMAN | 1.74 | -0.72 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, biploar disorder (bipolar schizoaffective disorder), sporadic creutzfeldt-jakob disease