rs8123900 chr20:768737 G>T
- Sequence
tcccgctctgccccctcccttctg[G/T]gggcctcagactccattccctccc
- ASB in cell types
- breast tumor keratinocytes
- ASB for transcription factors
- ESR1_HUMAN SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.74 | -5.07 | 2.00 | n/a | No Hit | |||
| SNAI2_HUMAN | -0.57 | 1.97 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Mucosa, Lung, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid