rs8127136 chr21:36661874 C>T
- Sequence
agaatgttaaccctctttttgttg[C/T]tatgaaaaaggcggataatatcta
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | 2.27 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, hdl cholesterol change with statins, hypertension (early onset hypertension), infant head circumference, ldl cholesterol, ldl cholesterol change with statins, longstanding arthritis, microalbuminuria, salmonella-induced pyroptosis, total cholesterol