rs8127471 chr21:42923980 T>C
- Sequence
aagggaacatgaactctaataaga[T/C]cttcagttcctgctacttcccgaa
- ASB in cell types
- HEK293 (embryonic kidney) erythroid cells GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia)
- ASB for transcription factors
- ZBT8A_HUMAN KDM6A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZBT8A_HUMAN | -1.43 | 2.34 | 1.50 | n/a | n/a | |||
| KDM6A_HUMAN | 0.46 | 2.36 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood