rs8127664 chr21:41460711 C>T
- Sequence
attcttaattcaatactaggcacg[C/T]gttctcgcagtggacatggcccag
- ASB in cell types
- ascending aorta
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ascending aorta | n/a | 2.30 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, college completion, mitral annular calcium, serum creatinine, systolic blood pressure (sbp), triglycerides, triglycerides change with statins, years of education