rs8127823 chr21:40386347 G>A
- Sequence
ttcagattccgaagctttagttga[G/A]ggcagttgaagaacctacaaggct
- ASB in cell types
- KMS-11 (Plasma cell myeloma) SK-N-SH (neuroblastoma) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 (Plasma cell myeloma) | 2.72 | -4.79 | 1.50 | |||
| SK-N-SH (neuroblastoma) | 2.56 | n/a | 1.00 | |||
| neural cell | 2.47 | n/a | 1.00 |
Items per page:
1 – 3 of 3