rs8128323 chr21:43789095 C>T
- Sequence
aattacaggcgtgagccaccgcgc[C/T]cggcacacccctggttttaaaaat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.08 | 0.63 | 1.05 | |||
| MCF7 (Invasive ductal breast carcinoma) | -2.45 | 2.39 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Whole_Blood