rs8132681 chr21:33950035 T>C
- Sequence
cgtgagcactcatctagtctaggc[T/C]gagctcctaaacaggaaatgtgtg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ZN687_HUMAN JUNB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN687_HUMAN | -1.76 | 2.10 | 1.00 | n/a | n/a | |||
| JUNB_HUMAN | 2.38 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood