rs8133510 chr21:42309869 G>A
- Sequence
gtcagtagagggcgctgttcggtc[G/A]ctttgtggtttggaccaggtttcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 2.04 | -1.84 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, hdl cholesterol change with statins, neuroblastoma (brain cancer), plasma aldosterone concentration, plasma aldosterone concentration corrected by plasma renin activity, resistance to kuru in aged women despite likely exposure, rheumatoid arthritis