rs8133793 chr21:31866488 A>G
- Sequence
tggacaggagtcagcacccagcga[A/G]aggctgtaaataagcctcagcgct
- ASB in cell types
- pancreas upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 2.01 | -0.89 | 1.11 | |||
| upper lobe of left lung | 1.98 | 0.07 | 1.00 |
Items per page:
1 – 2 of 2