rs8135325 chr22:40732892 C>T
- Sequence
gcctgttcctgcctcggggcagga[C/T]gcaccgccctagtgactgtaatac
- ASB in cell types
- VCaP (prostate carcinoma) BEAS-2B (bronchial epithelium) HMEC (human mammary epithelial cells) breast tumor
- ASB for transcription factors
- ANDR_HUMAN GCR_HUMAN CTCF_HUMAN PRGR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.96 | 0.14 | 2.39 | n/a | No Hit | |||
| GCR_HUMAN | 3.13 | -0.31 | 1.25 | n/a | No Hit | |||
| CTCF_HUMAN | 1.69 | 0.66 | 1.21 | n/a | No Hit | |||
| PRGR_HUMAN | 2.72 | n/a | 3.00 | 2.87 | Discordant |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Uterus, Whole_Blood