rs8135533 chr22:40732872 G>A
- Sequence
tgctgaataaacaagaaactgcct[G/A]ttcctgcctcggggcaggacgcac
- ASB in cell types
- BEAS-2B (bronchial epithelium) VCaP (prostate carcinoma) HMEC (human mammary epithelial cells) breast tumor
- ASB for transcription factors
- ANDR_HUMAN GCR_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.86 | -0.21 | 2.47 | -3.10 | Concordant | |||
| GCR_HUMAN | 3.13 | -0.70 | 1.25 | -4.05 | Concordant | |||
| CTCF_HUMAN | 1.48 | 0.54 | 1.24 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP 2 hour glucose, aortic valve calcium, fasting blood glucose, ldl cholesterol change with statins, parkinsons disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Uterus, Whole_Blood