rs8136127 chr22:40732783 T>C
- Sequence
gtgagaggcgagggcagagcctac[T/C]tacctttcacctcctagcacctga
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 3.15 | n/a | 3.00 | n/a | No Hit | |||
| ANDR_HUMAN | 1.75 | 0.68 | 2.29 | -0.26 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP 2 hour glucose, aortic valve calcium, fasting blood glucose, ldl cholesterol, ldl cholesterol change with statins, rheumatoid arthritis, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Uterus, Whole_Blood